View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17886_low_30 (Length: 234)
Name: NF17886_low_30
Description: NF17886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17886_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 53955539 - 53955348
Alignment:
| Q |
1 |
taaaggattgttggagaggtattcgaaaattatttatctagtgttgtcggaataagaccaagccatccaatttaatcaagaattgtcaat--gttcaacc |
98 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||| |||||||||||| ||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
53955539 |
taaaggattgttggagaggtgttcaaaaattatttatctagtgtt--cggaataagaccgagccatccaatttaaacaagaattgtcaattggttcaacc |
53955442 |
T |
 |
| Q |
99 |
atggttcattcttatagtcgcgtagaactggatcaaatcggttcggtcgtgattgaatgtgttattagtttaattctttttgttttcttatttt |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| || |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53955441 |
atggttcattcttatagtcgcgtagaactggatcgaatcggttcaatcaggattgaatgtgttattagtttaattctttttgttttcttatttt |
53955348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University