View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17887_low_1 (Length: 320)
Name: NF17887_low_1
Description: NF17887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17887_low_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 55 - 310
Target Start/End: Original strand, 14430728 - 14430981
Alignment:
| Q |
55 |
ttgtaatttgcatcaaaggataacttataaagttagaaagagtggtacccacctatactgatttgtatggagcaaagtatgatatttaggtcgaacatga |
154 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14430728 |
ttgtaatttgcatcaaaggataactta--aagttagaaagagtggtacccacctatactgatttgtatggagcaaagtatgatatttaggtcgaacatga |
14430825 |
T |
 |
| Q |
155 |
acatgatgaggctcatctttctcctcttcactacggcaaaaattgttactatgaaggagagtgtcttgcacgccccacttgcgagccgcggcgacaaaaa |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| |
|
|
| T |
14430826 |
acatgatgaggctcatctttctcctcttcactatggcaaaaattgttactatgaaggagagtgtcttgcacgcgccacttgcgagccgcggcgacagaaa |
14430925 |
T |
 |
| Q |
255 |
cttgggccagtcttgtaaatggactccctgtagggccttcctttctgtaccctttg |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14430926 |
cttgggccagtcttgtaaatggactccctgtagggccttcctttctgtaccttttg |
14430981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University