View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17888_high_24 (Length: 201)
Name: NF17888_high_24
Description: NF17888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17888_high_24 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 15 - 184
Target Start/End: Complemental strand, 38216081 - 38215912
Alignment:
| Q |
15 |
agagaagagtcaagagtttaaaaaatgctggtggtgctgctgctgtagaaacatgggagattaacatgtcttcttgttattcactattcgtttccaagtt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38216081 |
agagaagagtcaagagtttaaaaaatgctggtggtgctgctgctgtagaaacatgggagatcaacatgtcttcttgttattcactattcgtttccaagtt |
38215982 |
T |
|
| Q |
115 |
gaaggaggagaaaaagcaacttgttcagagtgttttggaacccaaaacccaatttgctattgctgcttct |
184 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38215981 |
gaaggaggagaaaaggcaacttgttcagagtgttttggaacccaaaacccaatttgctattgctgcttct |
38215912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University