View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17888_high_4 (Length: 442)
Name: NF17888_high_4
Description: NF17888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17888_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 400; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 400; E-Value: 0
Query Start/End: Original strand, 18 - 441
Target Start/End: Original strand, 30184539 - 30184962
Alignment:
| Q |
18 |
aaagcaatattgcaaatgggcccccaccttcagcgttggagtagagagcttgagtctggtattgtttccaatggcatgtttggccttgtgccgggtgagg |
117 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30184539 |
aaagccatattgcaaatgggcccccaccttcagcgttggagtagagagcttgagtctggtattgtttccaatggcatgtttggccttgtgccgggtgagg |
30184638 |
T |
|
| Q |
118 |
atgaactatttgctaatacaatcctcttacgccttgctgatgcatttagaggaggcaacacagaaatcaggctttctgttgtcagagttttcttgatcga |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30184639 |
atgaactatttgctaatacaatcctcttacgccttgctgatgcatttaggggaggcaacacagaaatcaggctttctgttgtcagagttttcttgatcga |
30184738 |
T |
|
| Q |
218 |
gagaaagcaccatgataacaggaagcacaagcagtgtaaagggttgctgtcagtggccagagtagctaaccatctggagttgttgaagcgggtgaaatct |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
30184739 |
gagaaagcaccatgataacaggaagcacaagcagtgtaaagggttgctgtcagtggccagagtagctaaccatctggagttgttgaagcaggtgaaatct |
30184838 |
T |
|
| Q |
318 |
gttttcaacagtggagattcagagtctaaggctctggctctggttctgtttggttgttgggctgattttgccaatgacaatgctcagatacgatacttga |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30184839 |
gttttcaacagtggagattcagagtctaaggctctggctctggttctgtttggttgttgggctgattttgccaatgacaatgctcagatacgatacttga |
30184938 |
T |
|
| Q |
418 |
tactttccacctttgctactcctc |
441 |
Q |
| |
|
||||||||||| ||| | |||||| |
|
|
| T |
30184939 |
tactttccacccttgtttctcctc |
30184962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University