View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17888_low_16 (Length: 309)
Name: NF17888_low_16
Description: NF17888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17888_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 268; Significance: 1e-149; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 13 - 291
Target Start/End: Original strand, 24849710 - 24849989
Alignment:
| Q |
13 |
agagacacatatgactagactacatcaacataaaattgggacaaatctagaggtgagttcccaattacctgaattgattcggggatacttgattccagtt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24849710 |
agagacacatatgactagactacatcaacataaaattgggacaaatctagaggtgagttcccaattacctgaattgattcggggatacttgattccagtt |
24849809 |
T |
 |
| Q |
113 |
atattaatctggttgatgatttgaactgcagtgtattatgtcttttgatattagccaggaagg-ttggtcgattgagactatggagttactaatctatga |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
24849810 |
atattaatctggttgatgatttgaactgcagtgtattatgtcttttgatattagccaggaaggttttgtcgattgagactatggagttactaatctatga |
24849909 |
T |
 |
| Q |
212 |
tacaacttaggagagagtacacaaaagtaaagaggccaaacactaataactgcaacatgcacaagatgtgcgaactgata |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24849910 |
tacaacttaggagagagtacacaaaagtaaagaggccaaacactaataactgcaacatgcacaagatgtgcgaactgata |
24849989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 83 - 138
Target Start/End: Complemental strand, 24863287 - 24863232
Alignment:
| Q |
83 |
gaattgattcggggatacttgattccagttatattaatctggttgatgatttgaac |
138 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
24863287 |
gaattgattctgggatacttgattccagttatgttaaactggttgatgatttgaac |
24863232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University