View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17888_low_18 (Length: 263)
Name: NF17888_low_18
Description: NF17888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17888_low_18 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 158 - 250
Target Start/End: Original strand, 3311555 - 3311650
Alignment:
| Q |
158 |
gagataatttccaccaggatataaatcttgaggt---cgcggtgcctccttctatatctcaacctccttccttatgttggggctcatatgctgcct |
250 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3311555 |
gagataattttcaccaggatataaatcttgaggttgtcgcggtgcctccttctatatctcaacctccttccttatgttggggctcatatgctgcct |
3311650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 56 - 104
Target Start/End: Original strand, 3311453 - 3311501
Alignment:
| Q |
56 |
ataattactaaatatggtcctcaaataaaatttccattcaactactaac |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3311453 |
ataattactaaatatggtcctcaaataaaattttcattcaactactaac |
3311501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University