View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17888_low_22 (Length: 250)
Name: NF17888_low_22
Description: NF17888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17888_low_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 11 - 235
Target Start/End: Original strand, 36636047 - 36636272
Alignment:
| Q |
11 |
cacagagaatggctggtatattatctatatattctctctaaacatagaaaaatcattatcaagaaaattaaaataacgacaaaaatttagagacagaaac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36636047 |
cacagagaatggctggtatattatctatatattctctctaaacatagaaaaatcattaccaagaaaattaaaataacgacaaaaatttagagacagaaac |
36636146 |
T |
|
| Q |
111 |
ttgtaa-gaaaacagcatttagattagttgtggttttgattgctttgtttacaggcagaagtgatatttttggggcagctttcacatccaaatttggtca |
209 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36636147 |
ttgtaaagaaaacagcatttagattagttgtggttttgattgctttgtttacaggcagaagtgatatttttggggcagctttcacatccaaatttggtca |
36636246 |
T |
|
| Q |
210 |
aattaattggatactgctgcgaaaac |
235 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
36636247 |
aattaattggatactgctgcgaaaac |
36636272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 222
Target Start/End: Complemental strand, 10845355 - 10845290
Alignment:
| Q |
157 |
tttacaggcagaagtgatatttttggggcagctttcacatccaaatttggtcaaattaattggata |
222 |
Q |
| |
|
|||||||||||||||||| ||| | |||||||| ||||||||||||||| ||||| |||||||| |
|
|
| T |
10845355 |
tttacaggcagaagtgatttttcttgggcagctaagacatccaaatttggtaaaattgattggata |
10845290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University