View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17888_low_26 (Length: 201)

Name: NF17888_low_26
Description: NF17888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17888_low_26
NF17888_low_26
[»] chr8 (1 HSPs)
chr8 (15-184)||(38215912-38216081)


Alignment Details
Target: chr8 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 15 - 184
Target Start/End: Complemental strand, 38216081 - 38215912
Alignment:
15 agagaagagtcaagagtttaaaaaatgctggtggtgctgctgctgtagaaacatgggagattaacatgtcttcttgttattcactattcgtttccaagtt 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
38216081 agagaagagtcaagagtttaaaaaatgctggtggtgctgctgctgtagaaacatgggagatcaacatgtcttcttgttattcactattcgtttccaagtt 38215982  T
115 gaaggaggagaaaaagcaacttgttcagagtgttttggaacccaaaacccaatttgctattgctgcttct 184  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38215981 gaaggaggagaaaaggcaacttgttcagagtgttttggaacccaaaacccaatttgctattgctgcttct 38215912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University