View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17889_high_3 (Length: 392)
Name: NF17889_high_3
Description: NF17889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17889_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 126 - 373
Target Start/End: Original strand, 31576114 - 31576358
Alignment:
| Q |
126 |
tggtcactttgagggtaataataactctcaagagcgtgtacctagctgaggttggtaatgtcacttcattgcagtaacatctgcacagctttcaatttct |
225 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31576114 |
tggtcactttgagggtaataa---ctcttaagagcgtgtacctagctgaggttggtaatgtcacttcattgcagtaacatctgcacagctttcaatttct |
31576210 |
T |
 |
| Q |
226 |
cacggcacatgcacctcataaatatgtgtactaaccgtcattatacttcactggtttaggaatgaggtcattgaatgaaactcaattggatatttcaaat |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31576211 |
cacggcacatgcacctcataaatatgtgtactaaccgtcattatacttcactggtttaggaatgaggtcattgaatgaaactcaattggatatttcaaat |
31576310 |
T |
 |
| Q |
326 |
tagatacttcaatagtagcttgacaaatatgaagaggttgttgcggtt |
373 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31576311 |
tagatacttcaatagtagcttgacaaatatgaagaggttgttacggtt |
31576358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 5 - 103
Target Start/End: Original strand, 31576016 - 31576114
Alignment:
| Q |
5 |
aaattggatcctctacaactgttgtatgatcttgcagttgtatgatgatctttataactgcaacacgacacagcaaccatagaggatctaggttcaaat |
103 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31576016 |
aaattggatcctcgacaactgttgtatgatgttgcagttgtatgatgatctctataactgcaacacgacacagcaaccatagaggatctaggttcaaat |
31576114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University