View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1788_low_19 (Length: 224)
Name: NF1788_low_19
Description: NF1788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1788_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 7 - 209
Target Start/End: Complemental strand, 4819518 - 4819316
Alignment:
| Q |
7 |
tccaagaatataaataaaaatcaagaggactgcaccctagaagaagaaaaaaccctaaagcatccttcaacaaggccacatataaccttgttgaacctct |
106 |
Q |
| |
|
||||| || |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
4819518 |
tccaaaaaaataaataaaaatcaagaggactacaccctagaagaagaaaaaaccctaaagcatccttcaacaaggccacatataaccatgttgagcctct |
4819419 |
T |
 |
| Q |
107 |
taaaaccatgataagtgccccacctagttcgtctccatcttaacgagaaagtttgcacaagctaagcattgccttattgaagaatatggtgaagagttat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4819418 |
taaaaccatgataagtgccccacctagttcgtctccatcttaacgagaaagtttgcacaagctaagcattgccttattgaagaatatggtgaagagttat |
4819319 |
T |
 |
| Q |
207 |
atg |
209 |
Q |
| |
|
||| |
|
|
| T |
4819318 |
atg |
4819316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University