View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17891_high_10 (Length: 237)
Name: NF17891_high_10
Description: NF17891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17891_high_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 32532035 - 32531818
Alignment:
| Q |
1 |
caatggtgactgtggaggagattcgtaaggctcaacgttccaatggccctgccactatcttggcttttggcactgccactccttctcactgtgtcactca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32532035 |
caatggtgactgtggaggagattcgtaaggctcaacgttccaatggccctgccactatcttggcttttggcactgccactccttctcactgtgtcactca |
32531936 |
T |
|
| Q |
101 |
agctgaatatcctgattactactttcgtatcaccaacagtgagcacatgactgaccttaaggaaaaattcaagcgcatgtgtatgtctctaattttacta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32531935 |
agctgaatatcctgattactactttcgtatcaccaacagtgagcacatgactgaccttaaggaaaaattcaagcgcatgtgtatgtctctaattttacta |
32531836 |
T |
|
| Q |
201 |
caaattttacaagctttt |
218 |
Q |
| |
|
||||||||| |||||||| |
|
|
| T |
32531835 |
caaattttataagctttt |
32531818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 111 - 183
Target Start/End: Original strand, 35250519 - 35250591
Alignment:
| Q |
111 |
cctgattactactttcgtatcaccaacagtgagcacatgactgaccttaaggaaaaattcaagcgcatgtgta |
183 |
Q |
| |
|
|||||||||||||||||| | || |||||||| |||||||| || || ||| | ||||||||| ||||||||| |
|
|
| T |
35250519 |
cctgattactactttcgtgttacaaacagtgaacacatgacagaactcaagcataaattcaagtgcatgtgta |
35250591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University