View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17891_high_13 (Length: 210)
Name: NF17891_high_13
Description: NF17891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17891_high_13 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 22 - 210
Target Start/End: Original strand, 4338312 - 4338500
Alignment:
| Q |
22 |
tcagtgctactgttgaatgtaatgagtattttctctctactttttaatcttatgtctaagatcataatttataatcatggaaataaacaaaaatgaaagt |
121 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4338312 |
tcagtgctactgttgaatgtaatgtgtattttctctctactttttaatcttatgtctaagattataatttataatcatggaaataaacaaaaatgaaagt |
4338411 |
T |
 |
| Q |
122 |
tttcttatgattatttgtttagctttaatgaattgattataaaaattcatttcaaaatcaaattaatcatagggtgtgtttatgaacga |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4338412 |
tttcttatgattatttgttttgctttaatgaattgattataaaaattcatttcaaaatcaaattaaacatagggtgtgtttatgaacga |
4338500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University