View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17891_low_10 (Length: 254)
Name: NF17891_low_10
Description: NF17891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17891_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 237
Target Start/End: Original strand, 43665261 - 43665480
Alignment:
| Q |
18 |
cataagagaatatatgttgatttttatatgagaaaaagctaagactacaaagatgataaacaataaaacttctgttattcttcggtcacatgaatatgat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
43665261 |
cataagagaatatatgttgatttttatatgagaaaaagctaagactacaaagatgataaacaataaaacatctattattcttcggtcacatgaatatgat |
43665360 |
T |
 |
| Q |
118 |
tacttatttatacggctttgctaacagtaaacaatctcccatgacagatgactcttttctgcattacagtacagaggaaaatattatagaatagaagatc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43665361 |
tacttatttatacggctttgctaacagtaaacaatctcccatgacagatgactcttttctgcattacagtacagaggaatatattatagaatagaagatc |
43665460 |
T |
 |
| Q |
218 |
ttaattgaatgacgtctctg |
237 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
43665461 |
ttaattgaatgacgtctctg |
43665480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University