View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17891_low_16 (Length: 206)
Name: NF17891_low_16
Description: NF17891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17891_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 5e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 1 - 196
Target Start/End: Original strand, 32532173 - 32532371
Alignment:
| Q |
1 |
aaacatagctcctataaatatatttttgacatggaaagaattgaggtggacaatacatgcaaaaactaag---tgagtaggtttgagggacggatagatt |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32532173 |
aaacatagctcctataaatatatttttgacatggaaagaattgaggtggacaatacatgcaaaaactaagaagtgagtaggtttgagggacggatagatt |
32532272 |
T |
 |
| Q |
98 |
agaagacacgtgtccttgggtattcttattaagatgtggtagatatggagccacatactaaaattaaatcaacaaaataatggtaattattaccctttg |
196 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32532273 |
agaagacacgtgttcttgggtattcttattaagatgtggtagatatggagccacatactaaaattaaatcaacaaaataatggtaattattaccctttg |
32532371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University