View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17892_low_2 (Length: 293)
Name: NF17892_low_2
Description: NF17892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17892_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 145 - 277
Target Start/End: Original strand, 41705065 - 41705193
Alignment:
| Q |
145 |
aacctgtgcctcactcttctttttcccctttataaacaacaaacaaaacactctcattctctcactcacatcatcacacaccactccatctacaaattca |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41705065 |
aacctgtgcctcactcttctttttcccctttataaacaacaaacaaaacactctcat--tctcactcatatcatcacacaccactccatctacaaattca |
41705162 |
T |
 |
| Q |
245 |
aaaactcttctcctctctctgtattcaagttcc |
277 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |
|
|
| T |
41705163 |
aaaactcttctc--ctctctgtattcaagttcc |
41705193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 19 - 136
Target Start/End: Complemental strand, 36722562 - 36722445
Alignment:
| Q |
19 |
gttggtgctgctggtgctcgtgctggcgaaaaatttcatagtggctgtgattcatctacatctgctgttgatgatgacgaaaattttgttattctcagtt |
118 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36722562 |
gttggtgctgctgctgctcgtgctggcaaaaaatttcatagtggctgtgattcatctacatctgctgttgatgatgacgaaaattgtgttattctcagtt |
36722463 |
T |
 |
| Q |
119 |
cttttactgcttcagtga |
136 |
Q |
| |
|
||| |||||||||||||| |
|
|
| T |
36722462 |
cttctactgcttcagtga |
36722445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 19 - 136
Target Start/End: Complemental strand, 36709690 - 36709573
Alignment:
| Q |
19 |
gttggtgctgctggtgctcgtgctggcgaaaaatttcatagtggctgtgattcatctacatctgctgttgatgatgacgaaaattttgttattctcagtt |
118 |
Q |
| |
|
||||||| |||||||||| ||||||| ||| | ||||||||||| |||||||||||| |||||| |||||||||||||||| ||| |||||||||||||| |
|
|
| T |
36709690 |
gttggtggtgctggtgctggtgctggtgaagattttcatagtggttgtgattcatcttcatctgttgttgatgatgacgaagattgtgttattctcagtt |
36709591 |
T |
 |
| Q |
119 |
cttttactgcttcagtga |
136 |
Q |
| |
|
||| | | |||||||||| |
|
|
| T |
36709590 |
cttctgccgcttcagtga |
36709573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University