View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17894_high_30 (Length: 246)
Name: NF17894_high_30
Description: NF17894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17894_high_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 13 - 238
Target Start/End: Complemental strand, 2786786 - 2786561
Alignment:
| Q |
13 |
aaaatcgccaagtccctttgtgggaacgaacctgctgtttccaactctcagtttgccctagtcacctatcatactcatggcatttatgctcctgttctcg |
112 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2786786 |
aaaatcgtcaagtccctttgtgggaacgaacctgctgtttccaacgctcagtttgccctagtcacctatcatactcatggcatttattctcctgttctcg |
2786687 |
T |
 |
| Q |
113 |
tgcaacgttctggctggacaagagatccagaagttttcttagattggttatcatctatatccttttccggtggtggttttaatgacaccgctgtcgctga |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2786686 |
tgcaacgttctggctggacaagagatccagaagttttcttagattggttatcatctatatccttttccggtggtggtttaaatgacaccgctgtcgctga |
2786587 |
T |
 |
| Q |
213 |
agggcttgctgaagctttgatgatgt |
238 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
2786586 |
agggcttgctgaagctttgatgatgt |
2786561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 109 - 234
Target Start/End: Original strand, 22515971 - 22516096
Alignment:
| Q |
109 |
ctcgtgcaacgttctggctggacaagagatccagaagttttcttagattggttatcatctatatccttttccggtggtggttttaatgacaccgctgtcg |
208 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||| ||||||||| | ||| || ||||||| | ||||| |||||||||||||||||| | ||| | | |
|
|
| T |
22515971 |
ctcgtgcaacgtactggctggacaagagacccagatgttttcttacagtggctagaatctataccattttctggtggtggttttaatgacgcagctattg |
22516070 |
T |
 |
| Q |
209 |
ctgaagggcttgctgaagctttgatg |
234 |
Q |
| |
|
|||||||||||||||||||| ||||| |
|
|
| T |
22516071 |
ctgaagggcttgctgaagctctgatg |
22516096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University