View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17894_low_10 (Length: 482)
Name: NF17894_low_10
Description: NF17894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17894_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 124; Significance: 1e-63; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 312 - 435
Target Start/End: Original strand, 29385726 - 29385849
Alignment:
| Q |
312 |
caccctggcacctttattttcctctttttgtctagcaaacatatattgctcttcatatatgtctctctttgagtaacttaaaattgtcataaaacaaaaa |
411 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29385726 |
caccctggcacctttattttcctctttttgtctagcaaacatatattgctcttcatatatgtctctctttgagtaacttaaaattgtcataaaacaaaaa |
29385825 |
T |
|
| Q |
412 |
ggtgaattggaggtttagtttgag |
435 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
29385826 |
ggtgaattggaggtttagtttgag |
29385849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 125 - 198
Target Start/End: Original strand, 29385542 - 29385615
Alignment:
| Q |
125 |
tgaatcaagtgagtgaatgaaagtgcaaagtaaattgcactaattaacaatctctttctgatcactttataaac |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29385542 |
tgaatcaagtgagtgaatgaaagtgcaaagtaaattgcactaattaacaatctctttctgatcactttataaac |
29385615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 111 - 167
Target Start/End: Original strand, 17853268 - 17853323
Alignment:
| Q |
111 |
caaagtgaatcaattgaatcaagtgagtgaatgaaagtgcaaagtaaattgcactaa |
167 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
17853268 |
caaagtgaatcaattgtatcaagtgagtgaatgaaagtgcaaa-tgaattgcactaa |
17853323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 126 - 167
Target Start/End: Complemental strand, 42055799 - 42055758
Alignment:
| Q |
126 |
gaatcaagtgagtgaatgaaagtgcaaagtaaattgcactaa |
167 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
42055799 |
gaatcaagtgagtgaatgaaagtgtaaagtgaattgcactaa |
42055758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University