View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17894_low_16 (Length: 305)
Name: NF17894_low_16
Description: NF17894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17894_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 97; Significance: 1e-47; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 4 - 111
Target Start/End: Complemental strand, 6609183 - 6609078
Alignment:
| Q |
4 |
aatatttcaataagttcacatacacttgctctagcaaaactataaaaaatttactactagaaaatgttaaatttatacagaaatttatagagtacatata |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6609183 |
aatatttcaataagttcacatacacttgctctagcaaaacta--aaaaatttactactagaaaatgttaaatttatacagaaatttatagagtacatata |
6609086 |
T |
 |
| Q |
104 |
tagaaatt |
111 |
Q |
| |
|
|||||||| |
|
|
| T |
6609085 |
tagaaatt |
6609078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 211 - 292
Target Start/End: Complemental strand, 6609050 - 6608969
Alignment:
| Q |
211 |
ctagggtgattatagagcataatcatggttgcactattgcacctgcactagaataacatcttgacatatatacttataactg |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6609050 |
ctagggtgattatagagcataatcatggttgcactattgcacctgcactagaataacatcttgacatatatacttataactg |
6608969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University