View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17894_low_20 (Length: 273)
Name: NF17894_low_20
Description: NF17894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17894_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 257
Target Start/End: Complemental strand, 31162779 - 31162524
Alignment:
| Q |
1 |
cattgattcatatttagttttactccaaagtatgttgagaagtcgctgttttgacttgcagcttgtgtgtgtgaaagtgatgtaattaattgggtgagtg |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31162779 |
cattgattcat-tttagttttactccaaaatatgttgagaagtcgctgtttggacttgcaacttgtgtgtgtgaaagtgatgtaattaattgggtgagtg |
31162681 |
T |
|
| Q |
101 |
aagtagggtatactgaaaaggaaaaccgaaagatgtgggaactttactatctttgagnnnnnnntcaactaacatgctattgctaagaataagaagctag |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
31162680 |
aagtagggtatactgagaaggaaaaccgaaagatgtgggaactttactatctttgagaaaaaaatcaactaacatgctattgctaagaataagaagctag |
31162581 |
T |
|
| Q |
201 |
gaagaagcatgcttgaagttgaaacttgaaatggtaaaaacgggaatgcttgctttg |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31162580 |
gaagaagcatgcttgaagttgaaacttgaaatggtaaaaacgggaatgcttgctttg |
31162524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University