View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17894_low_23 (Length: 262)
Name: NF17894_low_23
Description: NF17894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17894_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 54 - 245
Target Start/End: Original strand, 46221142 - 46221333
Alignment:
| Q |
54 |
ggttattgtaggcctgaaataactagtgcaaccgttgttgctaaaggggatttagggctcataaaaatctaagagattaatgttttcgaagtcgaattct |
153 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46221142 |
ggttattgtatgcctgaaacaactagtgcaaccgttgttgctaaaggggatttagggctcataaaaatctaagagattaatgttttcgaagtcgaattct |
46221241 |
T |
|
| Q |
154 |
ttaaggtaataaacctcactcactagaccataaatctacaatttgtccaactatgaaagtttacttcctcttattcgtcataataatacttt |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46221242 |
ttaaggtaataaacctcactcactagaccataaatctacaatttgtccaactatgaaagtttacttcctcttattcgtcataataatacttt |
46221333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 7 - 40
Target Start/End: Original strand, 46221090 - 46221123
Alignment:
| Q |
7 |
aatattgccaataaaagttggttattgtattcct |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
46221090 |
aatattgccaataaaagttggttattgtattcct |
46221123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University