View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17894_low_29 (Length: 253)
Name: NF17894_low_29
Description: NF17894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17894_low_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 133 - 241
Target Start/End: Original strand, 11396214 - 11396322
Alignment:
| Q |
133 |
gtggaaaatgtgataggaggcagaacaatgtatcgaatggattgcatgcgatgtcgcaacatcgatcacaaccgtctcagcagtcattttctcagggact |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11396214 |
gtggaaaatgtgataggaggcagaacaatgtatcgaatggattgcatgcgatgtcgcaacatcgatcacaaccgtctcagcagtcattttctcagggact |
11396313 |
T |
|
| Q |
233 |
ttcatctca |
241 |
Q |
| |
|
||||||||| |
|
|
| T |
11396314 |
ttcatctca |
11396322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 18 - 102
Target Start/End: Original strand, 11396099 - 11396183
Alignment:
| Q |
18 |
gaatcatgtgtttcagttcaaattcaggtgcttcttttttgagtatgcggttttaggtttctgtaactggatgaatatttatgaa |
102 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
11396099 |
gaatcatgtgtttcagttcaaattcacgtgcttcttttttgagtatgcagttttaggtttctgtaactggatgaatatttatgaa |
11396183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University