View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17894_low_32 (Length: 240)
Name: NF17894_low_32
Description: NF17894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17894_low_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 15 - 227
Target Start/End: Complemental strand, 559798 - 559576
Alignment:
| Q |
15 |
tcacgataatcgtctaagaaagagtgcattaaagtcaactcaaccaactgcaatttttcataattgtgag----------tgccactagactctcaccct |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
559798 |
tcacgataatcgtctaagaaagagtgcattaaagtcaactcaaccaactataatttttcataattgcgaggaaaaccaactgccactagactctcaccct |
559699 |
T |
|
| Q |
105 |
attaatatcctaaatttcccttaaccacacaagaaggtcttcaatattgttctcgttattattcctgccagtgttaatacaaagaacatatccaaccaaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
559698 |
attaatatcctaaatttcccttaaccacacaagaaggtcttcaatattgttctcgttattattcctgccagtgttaatacaaagaacatatccaaccaaa |
559599 |
T |
|
| Q |
205 |
gatatagcatatcatgtgtcttc |
227 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
559598 |
gatatagcatatcatgtgtcttc |
559576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 16 - 80
Target Start/End: Complemental strand, 558111 - 558047
Alignment:
| Q |
16 |
cacgataatcgtctaagaaagagtgcattaaagtcaactcaaccaactgcaatttttcataattg |
80 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||||||| ||| ||||||||||| |
|
|
| T |
558111 |
cacgataatcgtccaagaaagagtgcattaaagttaactcaaccaactataatatttcataattg |
558047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 142 - 214
Target Start/End: Complemental strand, 557974 - 557902
Alignment:
| Q |
142 |
tcttcaatattgttctcgttattattcctgccagtgttaatacaaagaacatatccaaccaaagatatagcat |
214 |
Q |
| |
|
|||||||| |||||||| ||||| || |||| |||||| ||||||||||||||| |||||||| |||||||| |
|
|
| T |
557974 |
tcttcaatgttgttctcattattgtttctgctagtgttgttacaaagaacatatcgaaccaaagttatagcat |
557902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University