View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17894_low_36 (Length: 230)
Name: NF17894_low_36
Description: NF17894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17894_low_36 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 22 - 214
Target Start/End: Complemental strand, 4973061 - 4972874
Alignment:
| Q |
22 |
gtgtaaaaacaaaattccctatnnnnnnnngtgtaaaaacagcatcgaatcgaatcgaatcaagtcaaacatttcatccacataactgaaaaagaataga |
121 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| || |
|
|
| T |
4973061 |
gtgtaaaaacaaaattccctataaaaaaaagtgtaaaaacagcatcgaatcgaatc-----aagtcaaacatttcatccacataactaaaaaagaattga |
4972967 |
T |
 |
| Q |
122 |
aattagtcaaacattgtnnnnnnncattttgcaaacgttttccttcccagaacaccgcgtaggcgcagccttctgttgattccacaaaaacaa |
214 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4972966 |
aattagtcaaacattgtaaaaaaacattttgcaaacgttttccttcccagaacaccgcgtaggcgcagccttttgttgattccacaaaaacaa |
4972874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University