View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17894_low_38 (Length: 208)
Name: NF17894_low_38
Description: NF17894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17894_low_38 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 21 - 191
Target Start/End: Complemental strand, 3863609 - 3863439
Alignment:
| Q |
21 |
gccacataaatcataaactaatattgccaaataagaagctattgcagattccattatttctttcaatcgcaatttctataataagcatgcaacaataccg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
3863609 |
gccacataaatcataaactaatattgccaaataagaagctattgcagattccattatttctttccatcgcaatttctaaaataagcatgcaacactaccg |
3863510 |
T |
|
| Q |
121 |
tgttggtgctggtttacatgtatttgtgataacaatcatgagctggtatgattcggagttcggactgatgg |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3863509 |
tgttggtgctggtttacatgtatttgtgataacaatcatgagctggtatgattcggagttcggacagatgg |
3863439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University