View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17895_high_3 (Length: 398)
Name: NF17895_high_3
Description: NF17895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17895_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 3e-92; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 3e-92
Query Start/End: Original strand, 12 - 235
Target Start/End: Complemental strand, 27843738 - 27843520
Alignment:
| Q |
12 |
atcatcaactatgtattgcatgaaaccctaattttctatttatatttcctcaaaattgctagttatggaatggaaaatagtgttaaaatcaacacaaatt |
111 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
27843738 |
atcatgaactatgtattgcatgaaaccctaattttctatttatatttcctcaaaactgctagttatggaa-----aatagtgttaaaatcaacagaaatt |
27843644 |
T |
 |
| Q |
112 |
tttaggtgagggtcagatgatggtaataaaataagttgggtgaaatgggaggacatttgtaggtcgaagagaagcgaaatacttggggtgaaggattgaa |
211 |
Q |
| |
|
|||||| ||||||| |||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27843643 |
tttaggggagggtcggatggcggtaataaaataagttgggtgaaatgggaggacatttgtagatcgaagagaagcgaaatacttggggtgaaggattgaa |
27843544 |
T |
 |
| Q |
212 |
gattttgcaacaaaacacatttag |
235 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
27843543 |
gattttgcaacaaaacacatttag |
27843520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 295 - 379
Target Start/End: Complemental strand, 27843378 - 27843294
Alignment:
| Q |
295 |
aatactatggaaatggtttgggaagaaaatagggtgggaaaataaattctcaaataaaaaaggtcaattggatacatgcaaaggg |
379 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27843378 |
aatactgtagaaatggtttgggaagaaaatagggtgggaaaataaattctcaaataaaaaaggtcaattggatacatgcaaaggg |
27843294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University