View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17895_high_4 (Length: 356)
Name: NF17895_high_4
Description: NF17895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17895_high_4 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 16 - 356
Target Start/End: Complemental strand, 52988170 - 52987830
Alignment:
| Q |
16 |
atgaaatatctattgacatcataaccgagcacgttgaattagcctcgatgcatggttgttcaagtctggcagagaaagaaaaagattcttgtacagactg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
52988170 |
atgaaatatctattgacatcataaccgagcacgttgaattagcctcgatgcatggttgttcaaatctggcagagaaagaaaaagattcttgtaaagactg |
52988071 |
T |
|
| Q |
116 |
ccccaaattgcctgttgtgtgtggtggctgtgagggtccaaatgagagggaagttagtccatgttgcaagaatgagggctattcaaaggaatcgatcgaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
52988070 |
ccccaaattgcctgttgtgtgtggtggctgtgagggtccaaatgagagggaagttagtccatgttgcaagaatgagggctattcaaaggaatcgatagaa |
52987971 |
T |
|
| Q |
216 |
tcgtcaattacgcatgcttgcattagttttgacaagagagaagttggtggatgttgcaagagctacatgaaggaatgctgtggcaggcatggacattcag |
315 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52987970 |
tcgtcaattatgcatgcttgcattagttttgacaagagagaagttggtggatgttgcaagagctacatgaaggaatgctgtggcaggcatggacattcag |
52987871 |
T |
|
| Q |
316 |
gggcaggtagttttgtaggtttatcagaaattgttacagaa |
356 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
52987870 |
gggctggtagtttcgtaggtttatcagaaattgttacagaa |
52987830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University