View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17896_high_13 (Length: 386)
Name: NF17896_high_13
Description: NF17896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17896_high_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 346; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 346; E-Value: 0
Query Start/End: Original strand, 19 - 376
Target Start/End: Complemental strand, 38215830 - 38215473
Alignment:
| Q |
19 |
ttatggtcttctagttttcatgaaatcttttgtacatagctatgcttggaatatgaatctgaattaacggttgtctttagagaatttctctcacataatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38215830 |
ttatggtcttctagttttcatgaaatcttttgtacatagctatgcttggaatatgaatctgaattaacggttgtctttagagaatttctctcacataatt |
38215731 |
T |
|
| Q |
119 |
aaggatttaaaggatattcacttggagtataaaattgatttgccacgtcaaaattcaatcagttttacactcgcatctaatcaaaatctaatattttgcc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38215730 |
aaggatttaaaggatattcacttggagtataaaattgatttgccacgtcaaaattcaatcagttttacactcgcatctaatcaaaatctaatgttttgcc |
38215631 |
T |
|
| Q |
219 |
acatcatctctattggttacttgatcattaaactctaaaaaatagtgggtcgataattttgtgaccgaaataaatatcttcatcataccaattggctttt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38215630 |
acatcatctctattggttacttgatcattaaactctaaaaaatagtgggtcgataattttgtgaccgaaacaaatatcttcatcataccaattggctttt |
38215531 |
T |
|
| Q |
319 |
caatgatggacgaatttgaacaatttcaagaccactgcgtgattaagtcattcctttg |
376 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38215530 |
caatgatggacgaatttgaacaatttcaagaccactgcgtgatcaagtcattcctttg |
38215473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University