View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17896_high_25 (Length: 284)
Name: NF17896_high_25
Description: NF17896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17896_high_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 91 - 269
Target Start/End: Original strand, 39088565 - 39088743
Alignment:
| Q |
91 |
atatttttactgttcactaaagaaacaaaaaataattaagtagctaattaatcttttttggttcaagtagttaattaatctttaacaaggttgagtaata |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39088565 |
atatttttactgttcactaaagaaacaaaaaataattaagtagctaattaatcttttttggttcaagtagttaattaatctttaacaaggttgagtaata |
39088664 |
T |
 |
| Q |
191 |
tattaagagagttacccaggttgggggattttcagtaggaccatccaatccaatatgtgccacatgctttacatctgtg |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39088665 |
tattaagagagttacccaggttgggggattttcagtaggaccatccaatccaatatgtgccacatgctttacatctgtg |
39088743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 238 - 268
Target Start/End: Complemental strand, 15587662 - 15587632
Alignment:
| Q |
238 |
atccaatatgtgccacatgctttacatctgt |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
15587662 |
atccaatatgtgccacatgctttacatctgt |
15587632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University