View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17896_high_33 (Length: 253)
Name: NF17896_high_33
Description: NF17896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17896_high_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 9 - 230
Target Start/End: Original strand, 44473530 - 44473751
Alignment:
| Q |
9 |
agcagagatccgtacaactttcttctcgtgcccaaaaacttgaagtggcacctgaaacattacagacaagtgaataaaatatcgcaaacaagaaaatgct |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44473530 |
agcagagatccgtacaactttcttctcgtgcccaaaaacttgaagtggcacctgaaacattacagacaagtgaataaaatatcgcaaacaagaaaatgct |
44473629 |
T |
 |
| Q |
109 |
ggcaagtaatgcactcatgaacattagagcaaaagaacaagatgttgcaattgtcatcagtttacttgacaaaaatacaggaaaaaaggcaaagtaatca |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44473630 |
ggcaagtaatgcactcatgaacattagagcaaaagaacaagatgttgcaattgtcatcagtttacttgacaaaaatacaggaaaaaaggcaaagtaatca |
44473729 |
T |
 |
| Q |
209 |
tacaactgagtagggtctactc |
230 |
Q |
| |
|
|||||||||||||||| ||||| |
|
|
| T |
44473730 |
tacaactgagtagggtttactc |
44473751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University