View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17896_high_35 (Length: 233)
Name: NF17896_high_35
Description: NF17896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17896_high_35 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 35696822 - 35697038
Alignment:
| Q |
1 |
taacagtaattgtgatgccaagcatatgatgacgcttcaacgatcacaaagcgnnnnnnntgattcgacgattaatgattatgtttataatcctaatgga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35696822 |
taacagtaattgtgatgccaagcatatgatgacgcttcaacgatcacaaagcgaaaaaaatgattcgacgattaatgattatgtttataatcctaatgga |
35696921 |
T |
|
| Q |
101 |
aaaaacggttacggtggtgaatgtgagtctgaaattagtgttcctactgggaagaaaggtgtgatcgtgaacgcgaatggatcgttgtgttcggatgttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35696922 |
aaaaacggttacggtggtgaatgtgagtctgaaattagtgttcctactgggaagaaaggtgtgatcgtgaacgcgaatggatcgttgtgttcggatgttg |
35697021 |
T |
|
| Q |
201 |
gaccttcaccgtctgtg |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
35697022 |
gaccttcaccgtctgtg |
35697038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University