View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17896_high_42 (Length: 218)
Name: NF17896_high_42
Description: NF17896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17896_high_42 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 9994858 - 9994637
Alignment:
| Q |
1 |
ctttttatttgtttattttcttcaagatatcgcaaaacaaaggagattatcctcaatgatagtaatttgtt-ctcttagtttatgaagtt---------- |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9994858 |
ctttttatttgtttattttcttcaagatatcgcaaaacaaatgagattatcctcaatgatagtaatttgtttctcttagtttatgaagtttgttttatga |
9994759 |
T |
|
| Q |
90 |
----gagaccgattttagcccaatatttatttcataatcacatttttggtacctttttctatatccgttgcatggctagatctattgattccgtcattac |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9994758 |
agttgagaccgattttagcccaatatttatttcataatcacatttttggtacctttttctatatccgttgcatggctagatctattgattccgtcattac |
9994659 |
T |
|
| Q |
186 |
gatactttattattcctccttt |
207 |
Q |
| |
|
|||||||||||||| ||||||| |
|
|
| T |
9994658 |
gatactttattatttctccttt |
9994637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 79 - 143
Target Start/End: Original strand, 9414015 - 9414080
Alignment:
| Q |
79 |
tttatgaagttgagaccgattttagcccaatatttatttca-taatcacatttttggtaccttttt |
143 |
Q |
| |
|
||||||||||||||||| ||||| || || ||||| ||||| |||||||||||| | ||||||||| |
|
|
| T |
9414015 |
tttatgaagttgagacctattttggcacattatttctttcattaatcacattttggttaccttttt |
9414080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University