View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17896_low_44 (Length: 209)

Name: NF17896_low_44
Description: NF17896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17896_low_44
NF17896_low_44
[»] chr2 (1 HSPs)
chr2 (2-117)||(7802310-7802425)
[»] chr1 (1 HSPs)
chr1 (143-190)||(6492164-6492211)


Alignment Details
Target: chr2 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 2 - 117
Target Start/End: Complemental strand, 7802425 - 7802310
Alignment:
2 ttttctgaaaagtttgtgtttttatatgtannnnnnnatgaaaatttggctttaaagaaatgggggatttgtgttttttaaggtattcaatattcatgtt 101  Q
    ||||||||||||||||||||||||||||||       |||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||    
7802425 ttttctgaaaagtttgtgtttttatatgtatttttttatgaaaatttggttataaagaaatgggggatttgtgttttttaaggtattcaatattcatgtt 7802326  T
102 tgggtttatgaatagg 117  Q
    ||||||||||||||||    
7802325 tgggtttatgaatagg 7802310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 143 - 190
Target Start/End: Original strand, 6492164 - 6492211
Alignment:
143 aaaccaaaggaattcattaattgaaaactatgtatacaaattaacagg 190  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
6492164 aaaccaaaggaattcattaattgaaaactatgtatacaaattaacagg 6492211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University