View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17896_low_44 (Length: 209)
Name: NF17896_low_44
Description: NF17896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17896_low_44 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 2 - 117
Target Start/End: Complemental strand, 7802425 - 7802310
Alignment:
| Q |
2 |
ttttctgaaaagtttgtgtttttatatgtannnnnnnatgaaaatttggctttaaagaaatgggggatttgtgttttttaaggtattcaatattcatgtt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7802425 |
ttttctgaaaagtttgtgtttttatatgtatttttttatgaaaatttggttataaagaaatgggggatttgtgttttttaaggtattcaatattcatgtt |
7802326 |
T |
|
| Q |
102 |
tgggtttatgaatagg |
117 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
7802325 |
tgggtttatgaatagg |
7802310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 143 - 190
Target Start/End: Original strand, 6492164 - 6492211
Alignment:
| Q |
143 |
aaaccaaaggaattcattaattgaaaactatgtatacaaattaacagg |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6492164 |
aaaccaaaggaattcattaattgaaaactatgtatacaaattaacagg |
6492211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University