View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17897_high_29 (Length: 391)
Name: NF17897_high_29
Description: NF17897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17897_high_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 18 - 227
Target Start/End: Original strand, 28670166 - 28670374
Alignment:
| Q |
18 |
gggatatcaccagtttcaacttcaccacttcctctacctctcaacaattctcttagtgttgataactttgaactcaactaaagtgagtgttcttgtttgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28670166 |
gggatatcaccagtttcaacttcaccacttcctctacctctcaacaattctctttgtgttgataactttgaactcaactaaagtgagtgttcttgtttgg |
28670265 |
T |
 |
| Q |
118 |
ggtatcatattaacccctagttgtgtttatgtgaattttgtgtatgtatatccattgtaggagcaatgatgtgattgtttgtttttatgcgagtcttgat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28670266 |
ggtatcatattaacccctagttgtgtttatgtgaattttgtgtatgtatat-cattgtaggagcaatgatgtgattgtttgtttttatgcgagttttgat |
28670364 |
T |
 |
| Q |
218 |
ttgtgtccat |
227 |
Q |
| |
|
|||||||||| |
|
|
| T |
28670365 |
ttgtgtccat |
28670374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 251 - 384
Target Start/End: Original strand, 28670373 - 28670512
Alignment:
| Q |
251 |
atactatgtgtatgtatgtgtatatgtcttggtaatagttgaatgaattttgtgcaaacatgattcatgacttcttgagtgatttgtatt------tgaa |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28670373 |
atactatgtgtatgtatgtgtatatgtcttggtaatagttgaatgaattttgtgcaaacatgattcatgacttcttgagtgatttgtatttgaacatgaa |
28670472 |
T |
 |
| Q |
345 |
catatagaattttatcaagtaattatgattgtgatgatgt |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28670473 |
catatagaattttatcaagtaattatgattgtgatgatgt |
28670512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University