View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17897_high_64 (Length: 255)
Name: NF17897_high_64
Description: NF17897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17897_high_64 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 139 - 255
Target Start/End: Complemental strand, 14108271 - 14108155
Alignment:
| Q |
139 |
aaacgtgtttatttatcatagtgtatgatttgcttcaaagcgagtatttctactata--atatgcttccnnnnnnnnnntctccaggacgtcacttgaat |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
14108271 |
aaacgtgtttatttatcatagtgtatgatttgcttcaaagcgagtatttctactataatatatgcttcc--aaaaaaaatctccaggacgtcacttgaat |
14108174 |
T |
|
| Q |
237 |
ttctttgttggagtttcct |
255 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
14108173 |
ttctttgttggagtttcct |
14108155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University