View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17897_low_11 (Length: 513)
Name: NF17897_low_11
Description: NF17897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17897_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 349; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 349; E-Value: 0
Query Start/End: Original strand, 133 - 501
Target Start/End: Complemental strand, 46901506 - 46901138
Alignment:
| Q |
133 |
gcccacgttttcattgagcctagcagccgcagcaacagaagcagctacaccaccaggagtagcagtagcatcaggattattcctcatctcagcactagcc |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46901506 |
gcccacgttttcattgagcctagcagccgcagcaacagaagcagctacaccaccaggagtagcagtagcatcaggattattcctcatctcagcactagcc |
46901407 |
T |
 |
| Q |
233 |
accccagcagcatcttgccttgtcgcctccttatcagctggcagcttcgctgttgctccggtcagaacatctcccatcttaatcttctcctcctcacgtt |
332 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46901406 |
accccagcagcatcttgccttgtcgccgccttatcagctggcagcttcgctgttgctccggtcagaacatctcccatcttaatcttctcctcctcacgtt |
46901307 |
T |
 |
| Q |
333 |
gacactcagcagtgaaagctgctgcatattgagccattgaagccaaacctcccggtgttataatattactccccgtagctctcacctccgccgcttgtat |
432 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
46901306 |
gacactcagcattgaaagctgctgcagattgagccattgaagccaaacctcccggtgttataacattactccccgtagctctcacctccgccgcttgtat |
46901207 |
T |
 |
| Q |
433 |
cgcagaggcgtcactctgttccaccggcttgtcacccaccgtgtgggccgtcgcctctagtgcctctcc |
501 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
46901206 |
cgcagaggcgtcactctgttccaccggcttgtcgcccaccgtgtgggccgtcgcctctagtgcctctcc |
46901138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University