View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17897_low_44 (Length: 321)
Name: NF17897_low_44
Description: NF17897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17897_low_44 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 18 - 290
Target Start/End: Complemental strand, 52445008 - 52444737
Alignment:
| Q |
18 |
ccatactactttcacgcagctctatgcctttttgcatgagaggctaccaggaggggagggtgttgcgggtgttgtgggagatgctccttgaggtgttcat |
117 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52445008 |
ccatgctactttcgcgcagctctatgcctttttgcatgagaggctaccaggaggggagggtgttgcgggtgttgtgggagatgctccttgaggtgttcat |
52444909 |
T |
|
| Q |
118 |
ttgctgttggtttcccttttgtttagcttttggaacttgtttatgtttgctcatggagcaagtactttttgcattttgtgtgtttatgtttgctcataga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
52444908 |
ttgctgttggtttcccttttgtttagcttttggaacttgtttatgtttgctcatggagaaagtactttttgcattttttgtgtttatgtttgctcataga |
52444809 |
T |
|
| Q |
218 |
gcaatctattattgttattgtttgtgaattaagtactcttgaaacacgattaaagctctgctagacttttgaa |
290 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52444808 |
gcaatctattattgttattgttt-tgaattaagtactcttgaaacacgattaaagctctgctagacttttgaa |
52444737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University