View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17897_low_78 (Length: 237)
Name: NF17897_low_78
Description: NF17897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17897_low_78 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 21 - 237
Target Start/End: Complemental strand, 38584473 - 38584257
Alignment:
| Q |
21 |
gatcaagtttcttcaatttcagatgcattaatttaacactgcaaatggaattcgaattttgaaatttcataatctaatttgaattttcgtgtaccagaca |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38584473 |
gatcaagtttcttcaatttcagatgcattaatttaacactgaacatggaattcgaattttgaaatttcataatctaatttgaattttcgtgtaccagaca |
38584374 |
T |
 |
| Q |
121 |
aggaatctgctccgaattgctatattcaacatcagttatatcagaggactatttcctgagaagtacttcaatgacaagtctgttcccgcgttaggtaaaa |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38584373 |
aggaatctgctccgaattgctatattcaacatcagttatatcagaggactatttcctgagaagtacttcaatgacaagtctgttcccgcgttaggtaaaa |
38584274 |
T |
 |
| Q |
221 |
tcactattcagtcctcc |
237 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
38584273 |
tcactattcagtcctcc |
38584257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University