View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17897_low_81 (Length: 225)
Name: NF17897_low_81
Description: NF17897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17897_low_81 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 8 - 207
Target Start/End: Complemental strand, 3645301 - 3645102
Alignment:
| Q |
8 |
tgtcgaagaatatcgattaatatttgcacaatcacatggtttggtgaatgatccaacggcaaagattccattaagtgttttctggttgataccgcaattt |
107 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3645301 |
tgtcgaagaaaagcgattaatatttgcacaatcacatggtttggtgaatgatccaacggcaaagattccattaagtgttttctggttgataccgcaattt |
3645202 |
T |
|
| Q |
108 |
ttcatcgtgggatcgggagagtccttcatgtatatgggacaactagacttttttctcagagaatgtccagatgggatgaaaactatgagcatgggactat |
207 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3645201 |
ttcattgtgggatcgggagagtctttcatgtatatgggacaactagacttttttctcagagaatgtccagatgggatgaaaactatgagcatgggactat |
3645102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 38 - 196
Target Start/End: Complemental strand, 3655945 - 3655787
Alignment:
| Q |
38 |
atcacatggtttggtgaatgatccaacggcaaagattccattaagtgttttctggttgataccgcaatttttcatcgtgggatcgggagagtccttcatg |
137 |
Q |
| |
|
|||||||||||| || | ||||||||||||||||| ||||| ||||| || |||||| | || ||||||||| | || || || |||||| |||| ||| |
|
|
| T |
3655945 |
atcacatggttttgtagacgatccaacggcaaagatgccattgagtgtgttttggttggtgccacaatttttctttgttgggtctggagaggcctttatg |
3655846 |
T |
|
| Q |
138 |
tatatgggacaactagacttttttctcagagaatgtccagatgggatgaaaactatgag |
196 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||| | || |||||||||||||| |
|
|
| T |
3655845 |
tatatgggacaattagacttttttctaagagaatgtcctaaaggaatgaaaactatgag |
3655787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University