View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17897_low_85 (Length: 218)
Name: NF17897_low_85
Description: NF17897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17897_low_85 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 29 - 202
Target Start/End: Original strand, 2044893 - 2045056
Alignment:
| Q |
29 |
cctgcacccgcacccgcacccaatgctaaaagtcttagtagcgatgcatgcgatattcactcaaaggctttcctagatgtatgttgtttannnnnnncat |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| |
|
|
| T |
2044893 |
cctgcacccgcacccgcacccaatgctaaaagtcttagtagcgatgcatgcgatattcactcaaaggctttcctagatgtatgtt-ttttttttattcat |
2044991 |
T |
|
| Q |
129 |
atgattttactctcttacgttgtatgttgttgaaaataatatagtttgttcaaatttgactacgcaatagtatt |
202 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2044992 |
atgattttactctct-------tatgttgttgaaaata--atagtttgttcaaatttgactacgcaatagtatt |
2045056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 38 - 117
Target Start/End: Original strand, 2041651 - 2041730
Alignment:
| Q |
38 |
gcacccgcacccaatgctaaaagtcttagtagcgatgcatgcgatattcactcaaaggctttcctagatgtatgttgttt |
117 |
Q |
| |
|
||||| ||||||||| || |||||||| |||||||||||||| |||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
2041651 |
gcacctgcacccaatactcaaagtcttggtagcgatgcatgcaatattcactcaaaggctttccttgatgtaagttgttt |
2041730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 71 - 117
Target Start/End: Complemental strand, 37032748 - 37032702
Alignment:
| Q |
71 |
gatgcatgcgatattcactcaaaggctttcctagatgtatgttgttt |
117 |
Q |
| |
|
||||||||| ||||||| |||||||| |||| ||||||||||||||| |
|
|
| T |
37032748 |
gatgcatgcaatattcattcaaaggcattccaagatgtatgttgttt |
37032702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University