View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17897_low_88 (Length: 211)
Name: NF17897_low_88
Description: NF17897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17897_low_88 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 32 - 211
Target Start/End: Original strand, 20703473 - 20703663
Alignment:
| Q |
32 |
tattatgctaaaggttaacggatactaaacattgttctactacataaagaatctcactttacttgagaatactgattaattgtagtttag---------- |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
20703473 |
tattatgctaaaggttaacggatattaaacattgttctactacataaagaatctcacgttacttgagaatactgattaattgtagtttagaaacaacact |
20703572 |
T |
 |
| Q |
122 |
-agactcttcaatccaacgagacgccttttacaaaagaaaagattgtgaaggctcacacaaggccctcataatacttgaaaatgtgaatct |
211 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
20703573 |
cagactcttcaatccaacgagacgtcttttataaaagaaaaaattgtgaaggctcacacaaggccctcataatacttgaaaatgcgaatct |
20703663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University