View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17897_low_92 (Length: 201)
Name: NF17897_low_92
Description: NF17897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17897_low_92 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 125; Significance: 1e-64; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 63 - 187
Target Start/End: Complemental strand, 24900549 - 24900425
Alignment:
| Q |
63 |
ttgctatatctgggatcccgtagacgaataacacagtcattgaatgcaacaaactctcacctatgttaattaatttgtaatttcagcaattaatgcccgc |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24900549 |
ttgctatatctgggatcccgtagacgaataacacagtcattgaatgcaacaaactctcacctatgttaattaatttgtaatttcagcaattaatgcccgc |
24900450 |
T |
|
| Q |
163 |
aacattcgattacaattgatatatg |
187 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
24900449 |
aacattcgattacaattgatatatg |
24900425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 47
Target Start/End: Complemental strand, 24900599 - 24900569
Alignment:
| Q |
17 |
taggctttttgaattgacaagagactttatt |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
24900599 |
taggctttttgaattgacaagagactttatt |
24900569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University