View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17898_high_14 (Length: 362)
Name: NF17898_high_14
Description: NF17898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17898_high_14 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-100; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-100
Query Start/End: Original strand, 137 - 362
Target Start/End: Complemental strand, 33770637 - 33770414
Alignment:
| Q |
137 |
tcaattgtgggcaacattgaagtgcgatatataccttatgcaaaactacttcctgatgcattggtcctcgttattacgaagggatnnnnnnnnngtgctt |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| |
|
|
| T |
33770637 |
tcaattgtgggcaacattgaagtgcgatatataccttatgcaaaactacttcctgatgcattggtcctcgttattacgaagggataaaaaaa--gttctt |
33770540 |
T |
|
| Q |
237 |
aatgtggtcaaatcgattagtccaacccttgtacatagttatctagtttatcaaatgaaatatgtttcttttgactcattatactgtctcatgttcatta |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33770539 |
aatgtggtcaaatcgattagtccaacccttgtacatagttatctagtttatcaaatgaaatatgtttcttttgactcattatactgtctcatgttcatta |
33770440 |
T |
|
| Q |
337 |
gtataagtattctagattagcgcacc |
362 |
Q |
| |
|
| |||||||||||||||||||||||| |
|
|
| T |
33770439 |
gcataagtattctagattagcgcacc |
33770414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 9 - 86
Target Start/End: Complemental strand, 33771580 - 33771503
Alignment:
| Q |
9 |
acatcatcactcttttaaatcaatttacaccgtaactggcttgtttagaaaacacaactttgttttattcatttatgc |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
33771580 |
acatcatcactcttttaaatcaatttacacggtaactggcttgtttagaaaacacaactttgttttcttcttttatgc |
33771503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 13 - 86
Target Start/End: Original strand, 44144270 - 44144350
Alignment:
| Q |
13 |
catcactcttttaaatcaatttacaccgtaactggctt-------gtttagaaaacacaactttgttttattcatttatgc |
86 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||| |||| ||||||||||||||||||| ||| ||||||| |
|
|
| T |
44144270 |
catcactcttttaaatcaatttacacggtaactgactttgcaaaggtttggaaaacacaactttgttttcttcttttatgc |
44144350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University