View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17898_high_5 (Length: 473)
Name: NF17898_high_5
Description: NF17898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17898_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 453; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 453; E-Value: 0
Query Start/End: Original strand, 1 - 457
Target Start/End: Complemental strand, 40382992 - 40382536
Alignment:
| Q |
1 |
tttcaccattttagcttccttctgggctgggagctccttcgtcacgttcctctccggcgttgtttcgcatgtgatgcttggtttcaccgttgtggttgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40382992 |
tttcaccattttagcttccttctgggctgggagctccttcgtcacgttcctctccggcgttgtttcgcatgtgatgcttggtttcaccgttgtggttgct |
40382893 |
T |
 |
| Q |
101 |
attttagcttactttcttctcttcagtggattcttcatcagtagggataggattccaccttactggatatggttccattacctatcactggtgaagtacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40382892 |
attttagcttactttcttctcttcagtggattcttcataagtagggataggattccaccttactggatatggttccattacctatcactggtgaagtacc |
40382793 |
T |
 |
| Q |
201 |
cttttgaaggagtgcttcagaatgagtttgatattaagccaccaaggtgcttcgtcaaagggattcagatgtttgataacactccgcttggtgatgtccc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40382792 |
cttttgaaggagtgcttcagaatgagtttgatattaagccaccaaggtgcttcgtcaaagggattcagatgtttgataacactccgcttggtgatgtccc |
40382693 |
T |
 |
| Q |
301 |
agggagtttgaaggttgagctgttgaagagcttgagtagtacactagggactaacataacgagttctacttgtgttgttactggagctgatatactgaag |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40382692 |
agggagtttgaaggttgagctgttgaagagcttgagtagtacactagggactaacataacgagttctacttgtgttgttactggagctgatatactgaag |
40382593 |
T |
 |
| Q |
401 |
cagcaaggagtcacacaacttagtaaatggaactgcttgttcatcaccattgctctg |
457 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40382592 |
cagcaaggagtcacacaacttagtaaatggaactgcttgttcatcaccattgctctg |
40382536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University