View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17898_low_18 (Length: 318)
Name: NF17898_low_18
Description: NF17898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17898_low_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 13 - 298
Target Start/End: Original strand, 9457005 - 9457273
Alignment:
| Q |
13 |
atactgaatactgagtctaaacaacgtgcatgccagtgcattcctattaagttacataagaaacttgatctatacaaagannnnnnnggaacagatgatg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9457005 |
atactgaatactgagtctaaacaacgtgcatgccagtgcattcctattaagttacataagaaacttgatctatacaaagatttttt-ggaacagatgatg |
9457103 |
T |
 |
| Q |
113 |
atggatgattgtatcttctcatcttgtggagaccaacttcagacgcgtctgttagaggatattacatagttctttggatatatctggtgcgtccacccgg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || |
|
|
| T |
9457104 |
atggatgattgtatcttctcatcttgtggagaccaacttcagacgcgtctgttagaggatattacatagttctttggatatatctggtgcgtccatcagg |
9457203 |
T |
 |
| Q |
213 |
cagtttttccacacttaccggagcgcgtgcttaagaaacttgaatatgttcagaacatccctagacatcatgtcatctctgcacct |
298 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9457204 |
cagtttttccaca----------------cttaagaaacttgaatatgttcagaacatccctagacatcatgtcatctctgcacct |
9457273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University