View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17898_low_24 (Length: 276)
Name: NF17898_low_24
Description: NF17898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17898_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 271
Target Start/End: Original strand, 34301086 - 34301341
Alignment:
| Q |
18 |
aaaaataggtttcctaaataagtgggaccagtgtgaacccaaatttaaggtatcactggataagtttttgtggtgtttttactgttccctttcaaaagca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34301086 |
aaaaataggtttcctaaataagtgggaccagtgtgaacccaaatttaaggtatcactggataagtttttgtggtgtttttactgttccctttcaaaagca |
34301185 |
T |
 |
| Q |
118 |
ttcattctcggatcaagcattgttct--gnnnnnnnnttgtggtgtctctgctttttctaatccatgagaccaagcagcgcaatttttggtcaaggacta |
215 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34301186 |
ttcattctcggatcaagcattgttctaaaaaaaaaaattgtggtgtctctgctttttctaatccatgagaccaagcagcgcaatttttggtcaaggacta |
34301285 |
T |
 |
| Q |
216 |
ttacataccttataattatatttcaaacatacgtccaattataagcttcttctcac |
271 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
34301286 |
ttacataccttataattatatttcaaatatacgtccaattataagcttcttgtcac |
34301341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University