View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17898_low_28 (Length: 255)
Name: NF17898_low_28
Description: NF17898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17898_low_28 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 9456731 - 9456874
Alignment:
| Q |
5 |
caccgccacaggacacaccaccaccactacatgacactgagatggggtagctgatcagagatttgctggaggctcagctaatatgtcactgttgttgaac |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9456731 |
caccgccacaggacacaccaccaccactacatgacactgagatggggtagctgatcagagatttgctggaggctcagctaatatgtcactgttgttgaac |
9456830 |
T |
 |
| Q |
105 |
tttagtaagcatgtcgcaaccgaaaaatgagttgaatatgtagg |
148 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
9456831 |
tttagtaagcatgttgcaaccgaaaaatgagtcgaatatgtagg |
9456874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University