View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1789_high_24 (Length: 252)
Name: NF1789_high_24
Description: NF1789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1789_high_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 15 - 231
Target Start/End: Original strand, 45345159 - 45345372
Alignment:
| Q |
15 |
gattatactggagatattgatgatagaagaagcacatccggttatgtatttttactgtctggtggagcagtctcatgggcatcaaagaagcagcctgttg |
114 |
Q |
| |
|
|||||| |||||||||||||||||||||| | |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45345159 |
gattatgctggagatattgatgatagaaggaccacatccgattatgtatttttactgtctggtggagcagtctcatgggcatcaaagaagcagcctgttg |
45345258 |
T |
 |
| Q |
115 |
taacattgtccaccactgaggcagagtttgtggcagcctcctcttgtgcttgccaatgtgtgtggatgagaagggtgttggagaagattgggctctcaca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45345259 |
taacattgtccaccactgaggcagagtttgtggcagcctcctcttgtgctagccaatgtgtgtggatgagaagggtgttgg---agattgggctctcaca |
45345355 |
T |
 |
| Q |
215 |
aaacaagtgtactgtta |
231 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
45345356 |
aaacaagtgtactgtta |
45345372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 81 - 133
Target Start/End: Complemental strand, 654825 - 654773
Alignment:
| Q |
81 |
gcagtctcatgggcatcaaagaagcagcctgttgtaacattgtccaccactga |
133 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||| || ||||| || |||||||| |
|
|
| T |
654825 |
gcagtctcttgggcatcaaagaagcagcttgtagttacattatctaccactga |
654773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University