View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1789_high_25 (Length: 251)
Name: NF1789_high_25
Description: NF1789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1789_high_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 42803294 - 42803083
Alignment:
| Q |
1 |
ccaatcagaaatcaggagaggacaaagaattacatagcattctttcatgtacttgttttcatatctctataattttgggagaaaaacaaaagattctgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42803294 |
ccaatcagaaatcaggagaggacaaagaattacatagcattctttcatgtacttgttttcatatctctataattttgggagaaaaacaaaagattctgat |
42803195 |
T |
 |
| Q |
101 |
gataagagtcctttgatggctcaacaaataaagcaaaagaggccagtggtattaaatgttgcatgtgcaactattaattaggaatctttgttttaactat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42803194 |
gataagagtcctttgatggctcaacaaataaagcaaaagaggccagtggtattaaatgttgcatgtgcaactattaattaggaatctttgttttaactat |
42803095 |
T |
 |
| Q |
201 |
agctctttttct |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
42803094 |
agctctttttct |
42803083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 205 - 251
Target Start/End: Complemental strand, 42803056 - 42803010
Alignment:
| Q |
205 |
ctttttctctcataaccaacaaaatacaaggaactccatgttgcccc |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42803056 |
ctttttctctcataaccaacaaaatacaaggaactccatgttgcccc |
42803010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University