View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1789_high_30 (Length: 240)
Name: NF1789_high_30
Description: NF1789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1789_high_30 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 158 - 240
Target Start/End: Original strand, 23307339 - 23307421
Alignment:
| Q |
158 |
tattttgccttctgcatgtccctaagttctttatcttctttacccatcttcttcatcctagcagtctcaaggtcattgctcat |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23307339 |
tattttgccttctgcatgtccctaagttctttatcttctttacccatcttcttcatcctagcagtctcaaggtcattgctcat |
23307421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 17 - 69
Target Start/End: Original strand, 23307198 - 23307250
Alignment:
| Q |
17 |
accacttacacttttttcatccattacaaacataaatgcaaaatgatacatat |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23307198 |
accacttacacttttttcatccattacaaacataaatgcaaaatgatacatat |
23307250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 45; Significance: 9e-17; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 160 - 240
Target Start/End: Original strand, 32090335 - 32090415
Alignment:
| Q |
160 |
ttttgccttctgcatgtccctaagttctttatcttctttacccatcttcttcatcctagcagtctcaaggtcattgctcat |
240 |
Q |
| |
|
||||||||||| | ||||||||||||||| ||||| ||| ||| |||||||||||||||| |||||||||| |||||||| |
|
|
| T |
32090335 |
ttttgccttctctaagtccctaagttctttttcttccttagccagcttcttcatcctagcaatctcaaggtccttgctcat |
32090415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 160 - 240
Target Start/End: Original strand, 32067320 - 32067400
Alignment:
| Q |
160 |
ttttgccttctgcatgtccctaagttctttatcttctttacccatcttcttcatcctagcagtctcaaggtcattgctcat |
240 |
Q |
| |
|
||||||||||| | || |||||||||||| ||||| ||||| | |||||||||||||||| |||||||||| |||||||| |
|
|
| T |
32067320 |
ttttgccttctctaggttcctaagttctttttcttccttaccaagcttcttcatcctagcaatctcaaggtccttgctcat |
32067400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University