View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1789_high_43 (Length: 209)
Name: NF1789_high_43
Description: NF1789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1789_high_43 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 26 - 193
Target Start/End: Complemental strand, 4884183 - 4884016
Alignment:
| Q |
26 |
ggatgccattactattgtgtctggttgtggtgcattcataaagcttattgcatcataatagaatgtgattgagacatgatccatgttatgttgttgctac |
125 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4884183 |
ggatgccattactattgtgtctggttttggtgcattcataaagcttattgcatcataatagaatgtgattgagacatgatccatgttatgttgttgctac |
4884084 |
T |
|
| Q |
126 |
cattagagtaatccattcactgttattaattcccattcacacatagagggaaaaaatagtgtgttctg |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4884083 |
cattagagtaatccattcactgttattaattcccattcacacatagagggaaaaaatagtgtgttctg |
4884016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University